Tuesday 16th August 2022

Circular RNA Circ-0003006 Promotes Hepatocellular Carcinoma | CMAR

[ad_1]

Introduction

Hepatocellular carcinoma (HCC) is one of the most common malignancies worldwide and the second leading cause of tumor-related death.1,2 In recent years, researchers have made significant progress in the treatment of hepatocellular carcinoma (HCC), including liver cancer resection,3 liver transplantation,3,4 radiofrequency ablation,5 interventional therapy (chemotherapy and embolization),6 and comprehensive treatment of targeted drugs.7 Surgical resection is the best treatment of hepatocellular carcinoma (HCC), but because of hepatocellular carcinoma (HCC) onset conceals, early and no apparent symptoms. Most patients failed to do a related inspection, when liver area pain or particular symptoms, often lesions in the middle-late stage, thus intrahepatic and extrahepatic distant metastases, lost the optimal timing of surgery, leading to poor prognosis.3 In addition, due to the atypical imaging of early micrometastatic lesions and the lack of biomarkers for screening early metastatic lesions, the patients with HCC still have a high recurrence rate after surgical resection, so the overall survival rate of HCC patients is still poor.8 Therefore, it is of great significance for the patients with HCC to search for biomarkers related to early diagnosis, therapeutic intervention, and prognosis and to study the molecular mechanism of HCC occurrence and metastasis.

CircRNA, as an essential part of non-coding RNAs, has received more and more attention in recent years due to their unique structure and potential functions.9 In recent years, with the development of biological technology, especially bioinformatics and high-throughput sequencing technology, many circRNAs have been discovered. CircRNAs are a class of abundant, diverse, and highly conserved molecules with tissue-specific and developmental stage-specific expression levels.10–12 As a large number of RNAs have been studied, our understanding of their functional mechanisms has deepened. Specifically, circRNAs may sponge on miRNAs, thereby blocking the translation of target gene mRNAs, influencing gene expression by regulating splicing sites, transcription, or interaction with RNA-binding proteins.13–16 A large number of studies have shown that circRNAs play an essential role in biological processes. Some circRNAs have a specific expression in tumor tissues and play an essential role in the occurrence and development of tumors,17 such as pancreatic cancer,17 bladder cancer,18 cervical cancer,19 etc. At present, there are research reports on the role of circular RNA in the occurrence and development of hepatocellular carcinoma. For example, circCAMSAP1 is upregulated in vitro and in vivo and can promote the biological function of HCC. At the same time, circCAMSAP1 promotes HCC proliferation, migration, and invasion through the miR-1294/GRAMD1A pathway so that circCAMSAP1 may be a potential prognostic and therapeutic target for liver cancer.20 Knockdown of circPVT1 can inhibit the proliferation and glycolysis of liver cancer cells and promote cell apoptosis. circPVT1 can bind to miR-377, inhibiting miR-377 can restore the HCC cell effect mediated by circPVT1 knockdown.21 At the same time, studies have found that hsa_circ_0007456/miR-6852-3p/ICAM-1 axis is an essential signaling pathway in hepatocellular carcinoma immune escape and tumorigenesis.22 Since circRNAs have a closed ring structure and are not affected by exonuclease or other factors, their expression is relatively stable, and they have the potential to become tumor biomarkers. Therefore, it is of great significance to study the role of circRNA in tumor development and its specific molecular mechanism and to explore whether circRNA can be used as a stable biomarker in early diagnosis, therapeutic intervention, and prognosis analysis of tumors.

In this study, we screened the differentially expressed circRNAs in HCC through bioinformation analysis and focused on the influence of circ-0003006 on the biological process of HCC. Based on the database of Circbank, we found that the features of circ-0003006, lenth is 324bp, host gene symbol is FLNB and the position is chr3: 58111307–58112489. Circ-0003006 was significantly elevated in HCC and effectively promoted the development of hepatocellular carcinoma. Downregulation of circ-0003006 inhibited HCC progression by regulating the miR-542-3p/HIF-1A axis. Therefore, it is suggested that circ-0003006/miR-542-3p/HIF-1A axis may be a new target of HCC.

Materials and Methods

Patients and Clinical Samples

A total of 115 patients with HCC admitted to Jiangxi Cancer Hospital from May 2018 to October 2020 were selected for their tumors and corresponding paracancerous tissue samples, which were collected and quickly stored in a refrigerator at −80°C for detection. All patients were biopsies and pathologically confirmed to be HCC. The Institutional Review Committee has approved this study of Jiangxi Cancer Hospital, and all patients have agreed and signed written informed consent. Studies involving patient specimens: all the tumor specimens and para tumor samples were collected with written informed consent in accordance with the Declaration of Helsinki and with the approval of the Ethical Committee of Jiangxi Cancer Hospital (Approval No. CHJX-20180136, approve date: July 17, 2019).

Cell Lines and Cell Culture

Human hepatocellular carcinoma cells were purchased from the American Type Culture Collection (ATCC; Manassas, VA, USA). The corresponding complete growth medium was selected for them needed. The hepatocellular carcinoma cells were cultured in an incubator at 37°C, 5% CO2, and saturated humidity for routine culture.

Real-Time Fluorescent Quantitative PCR Detection (qRT-PCR)

The trizol method was used to extract total cell RNA and detect RNA concentration. Reverse transcription was used to synthesize single-stranded cDNA (Applied Biosystems, Carlsbad, CA, USA), and PCR amplification was performed according to the real-time fluorescent quantitative PCR kit instructions (TaKaRa Biotechnology Co. Ltd., Liaoning China). The PCR primers (Additional File 1: Table 1) were designed by Guangzhou Ruibo Biotechnology Co., Ltd. (Guangzhou, China). The PCR amplification conditions are as follows: 94°C pre-denaturation for 2 minutes, 1 cycle; 94°C denaturation for 30 seconds, 62°C annealing for 30 seconds, 72°C extension for 30 seconds, and 38 cycles. The experiment was repeated three times.

Luciferase Reporter

The sequences of circ-0003006 and HIF-1A 3ʹUTR containing miR-542-3p binding sites were inserted into luciferase vectors pmirGLO to construct wild-type (WT) circ-0003006 and HIF-1A plasmids. The mutant-type (MUT) vectors were acquired by mutating binding sites with miR-542-3p. Further, the cells were co-transfected with WT or MUT plasmids and miR-542-3p mimic or miR-NC. Then, the luciferase activity was examined with the microplate reader System.

Western Blot Experiment

The indicated group cell was collected in the ice, and the total protein was extracted and checked the total protein concentration according to the instructions of the BCA kit (Leagene, Beijing, China). The protein samples were boiled and denatured, and 70 μg per well was loaded into the SDS-PAGE gel wells for electrophoresis separation, and then transferred to PVDF membrane. After being blocked with 5% skimmed milk powder for 2 hours, the membrane was reacted with the corresponding primary antibody overnight at 4°C. The secondary antibody labeled with horseradish peroxidase was reacted for 2 hours at room temperature. After exposure with chemiluminescent agent, GAPDH was used as internal reference, and the gel imaging system was used for scanning analysis. The experiment was repeated three times.

Cell Transfection

Twenty-four hours before transfection, well-growing cells were seeded in a culture dish with a diameter of 60 mm, and the cells were transfected the next day. The mix LipofectamineTM2000 and siRNA serum-free DMEM medium were incubate at room temperature for 20 minutes. After cell transfection for 6 hours, replaced the serum-free medium with a complete medium containing 10% FBS, and continue culturing for 48 hours. Collect cells to verify the efficiency of silencing. The shRNA-circ-0003006 sequence (shRNA#1: CATCCCCGGTCTCCATGTAGT, shRNA#2: CACATCCCCGGTCTCCATGTA) was designed by Guangzhou Ruibo Biotechnology Co., Ltd. (Guangzhou, China).

CCK-8 Method to Detect Cell Viability

The cells were seeded in a…

[ad_2]

Read More:Circular RNA Circ-0003006 Promotes Hepatocellular Carcinoma | CMAR